Ostertag wolfram (25 Ergebnisse)

Sprache: Englisch
Verlag: Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
- Hardcover
Anbieter: Ammareal, Morangis, FrankreichAmmareal
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Gebraucht - Sehr gut
EUR 5,57
EUR 16,50 VersandVersand von Frankreich nach USAAnzahl: 1 verfügbar
Hardcover. Zustand: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations….

Sprache: Englisch
Verlag: Berlin ; Heidelberg ; Singapore ; Tokyo ; New York ; Barcelona ; Budapest ; Hong Kong ; London ; Milan ; Paris ; Santa Clara : Springer, 1996
- Hardcover
Anbieter: books4less (Versandantiquariat Petra Gros GmbH & Co. KG), Welling, Deutschlandbooks4less (Versandantiquariat Petra Gros GmbH & Co. KG)
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Gebraucht - Gut
EUR 42,95
EUR 19,95 VersandVersand von Deutschland nach USAAnzahl: 1 verfügbar
gebundene Ausgabe. Zustand: Gut. XII, 540 Seiten; illustriert; Der Erhaltungszustand des hier angebotenen Werks ist trotz seiner Bibliotheksnutzung sehr sauber. Es befindet sich neben dem Rückenschild lediglich ein Bibliotheksstempel im Buch; ordnungsgemäß entwidmet. In ENGLISCHER Sprache. Sprache: Englisch Gewicht in Gramm: 920….

- Hardcover
Anbieter: Romtrade Corp., STERLING HEIGHTS, MI, USARomtrade Corp.
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 99,60
Versand gratisVersand innerhalb von USAAnzahl: 1 verfügbar
Zustand: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.

- Softcover
Anbieter: Ria Christie Collections, Uxbridge, Vereinigtes KönigreichRia Christie Collections
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 116,63
EUR 14,00 VersandVersand von Vereinigtes Königreich nach USAAnzahl: Mehr als 20 verfügbar
Zustand: New. In.

- Softcover
Anbieter: Ria Christie Collections, Uxbridge, Vereinigtes KönigreichRia Christie Collections
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 116,63
EUR 14,00 VersandVersand von Vereinigtes Königreich nach USAAnzahl: Mehr als 20 verfügbar
Zustand: New. In.

Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
NATO Advanced Research Workshop On "Vectors For Transfer And Expression Of Genes" (1988 : Wilsede, Germany); Dernick, Rudolf; Lother, Heinz; Heinrich-Pette-Institut Fur Experimentelle Virologie Und Immunologie; North Atlantic Treaty Organization. Scientific Affairs Division
- Softcover
Anbieter: Romtrade Corp., STERLING HEIGHTS, MI, USARomtrade Corp.
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 131,00
Versand gratisVersand innerhalb von USAAnzahl: 1 verfügbar
Zustand: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.

- Hardcover
Anbieter: Majestic Books, Hounslow, Vereinigtes KönigreichMajestic Books
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Gebraucht
EUR 140,41
EUR 7,60 VersandVersand von Vereinigtes Königreich nach USAAnzahl: 1 verfügbar
Zustand: Used. pp. 304 52:B&W 6.14 x 9.21in or 234 x 156mm (Royal 8vo) Case Laminate on White w/Gloss Lam.

- Hardcover
Anbieter: Biblios, frankfurt am main, HESSE, DeutschlandBiblios
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Gebraucht
EUR 145,10
EUR 9,95 VersandVersand von Deutschland nach USAAnzahl: 1 verfügbar
Zustand: Used. pp. 304.

- Softcover
Anbieter: Majestic Books, Hounslow, Vereinigtes KönigreichMajestic Books
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Gebraucht
EUR 162,17
EUR 7,60 VersandVersand von Vereinigtes Königreich nach USAAnzahl: 1 verfügbar
Zustand: Used. pp. 475.

- Softcover
Anbieter: moluna, Greven, Deutschlandmoluna
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 118,64
EUR 48,99 VersandVersand von Deutschland nach USAAnzahl: Mehr als 20 verfügbar
Zustand: New. Proceedings of the NATO Advanced Study Institute Gene Technology in Analysis and Treatment of Malignant and Inherited Human Disease Related to Development , held at Wilsede, Germany, and St. Petersburg, Russia, June 19-26, 1994The 11 th meeting in Mod.

- Softcover
Anbieter: Revaluation Books, Exeter, Vereinigtes KönigreichRevaluation Books
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 156,41
EUR 14,61 VersandVersand von Vereinigtes Königreich nach USAAnzahl: 2 verfügbar
Paperback. Zustand: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.

- Softcover
Anbieter: moluna, Greven, Deutschlandmoluna
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 118,64
EUR 48,99 VersandVersand von Deutschland nach USAAnzahl: Mehr als 20 verfügbar
Zustand: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.

- Softcover
Anbieter: Ria Christie Collections, Uxbridge, Vereinigtes KönigreichRia Christie Collections
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 165,94
EUR 14,00 VersandVersand von Vereinigtes Königreich nach USAAnzahl: Mehr als 20 verfügbar
Zustand: New. In.

- Hardcover
Anbieter: Ria Christie Collections, Uxbridge, Vereinigtes KönigreichRia Christie Collections
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 165,94
EUR 14,00 VersandVersand von Vereinigtes Königreich nach USAAnzahl: Mehr als 20 verfügbar
Zustand: New. In.

- Softcover
Anbieter: Biblios, frankfurt am main, HESSE, DeutschlandBiblios
Verkäufer/-in kontaktierenVerkäufer/-in mit 4 SternenZustand: Gebraucht
EUR 167,73
EUR 9,95 VersandVersand von Deutschland nach USAAnzahl: 1 verfügbar
Zustand: Used. pp. 475.

Stem Cells and Their Potential for Clinical Application
Bilko, Nadja M.|Fehse, Boris|Ostertag, Wolfram|Stocking, Carol|Zander, Axel R.
- Hardcover
Anbieter: moluna, Greven, Deutschlandmoluna
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 137,26
EUR 48,99 VersandVersand von Deutschland nach USAAnzahl: Mehr als 20 verfügbar
Gebunden. Zustand: New.

- Hardcover
Anbieter: Buchpark, Trebbin, DeutschlandBuchpark
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Gebraucht - Sehr gut
EUR 85,33
EUR 105,00 VersandVersand von Deutschland nach USAAnzahl: 1 verfügbar
Zustand: Sehr gut. Zustand: Sehr gut | Seiten: 274 | Sprache: Englisch | Produktart: Bücher | The NATO-ASI conference Stem Cells and Their Potential for Clinical Application featured cutting-edge presentations ranging from laboratory research findings to the latest therapeutic applications. This book features contributions from…many of the leading international scientists from North America and Western and Eastern Europe who participated in this conference. Articles cover a broad range of hot topics in stem cell and leukemia research.

- Hardcover
Anbieter: AHA-BUCH GmbH, Einbeck, DeutschlandAHA-BUCH GmbH
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 160,49
EUR 30,50 VersandVersand von Deutschland nach USAAnzahl: 2 verfügbar
Buch. Zustand: Neu. Druck auf Anfrage Neuware - Printed after ordering - This publication was initiated on the occasion of the NATO-Advanced Study Institute (ASI) meeting 'Stem Cells and their potential for clinical application' which took place from August 23 - 25, 2006 in Kyiv and from August 26 - 31, 2006 in Simeiz, Ukraine.…The meeting was devoted to 'hot topics' in Stem cell research such as Regulation of Haematopoietic and Non-haematopoietic Stem Cells, Clinical Application of Stem Cells, Preclinical Models and Gene Therapy. The editors are pleased that the original idea of a book could eventually be realised. This was made possible because of the willingness of many meeting participants to saddle themselves with the additional work of compiling their data and thoughts in form of an article for this edition. We are thus foremost grateful to all contributors for their valuable input. In accordance with the conference's main topics, the book is divided into five chapters - 'Haematopoietic stem cells and haematopoiesis', 'Biology of n- haematopoietic stem cells', 'Stem cells and malignancy', 'Cell processing; expansion and genetic modification' and 'Clinical haematopoietic stem cell transplantation'.
Weitere Bilder- Softcover
Anbieter: preigu, Osnabrück, Deutschlandpreigu
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 140,10
EUR 70,00 VersandVersand von Deutschland nach USAAnzahl: 5 verfügbar
Taschenbuch. Zustand: Neu. Stem Cells and Their Potential for Clinical Application | Nadja M. Bilko (u. a.) | Taschenbuch | xv | Englisch | 2007 | Springer | EAN 9781402064685 | Verantwortliche Person für die EU: Springer Verlag GmbH, Tiergartenstr. 17, 69121 Heidelberg, juergen[dot]hartmann[at]springer[dot]com | Anbieter: preig…u.

Sprache: Englisch
Verlag: Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
- Softcover
Anbieter: AHA-BUCH GmbH, Einbeck, DeutschlandAHA-BUCH GmbH
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 146,51
EUR 64,17 VersandVersand von Deutschland nach USAAnzahl: 2 verfügbar
Taschenbuch. Zustand: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is tr…iggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .

Sprache: Englisch
Verlag: Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
- Softcover
Anbieter: AHA-BUCH GmbH, Einbeck, DeutschlandAHA-BUCH GmbH
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 146,51
EUR 64,22 VersandVersand von Deutschland nach USAAnzahl: 2 verfügbar
Taschenbuch. Zustand: Neu. Neuware - The 11 th meeting in 'Modern Trends in Human Leukemia' took place from June 19 to 21, 1994 in Wilsede in the middle of the Liineburger Heide, South of Hamburg. Interwoven with the Leukemia program was the Nato-sponsored Symposium of the ASI-Series 'Gene Technology in Analysis of Malignant and… Inherited Human Diseases Related to Development' . The Wilsede meeting was continued on a ship of the Neva leading through lake Ladoga and lake Onega. The topics of both meetings included discussion on recent progress isolation and development of hematopoietic stem cells, genes crucial for development and diseases, methods of gene transfer, application of gene transfer; oncogenes and anti-oncogenes as targets for gene therapy; receptors and their ligands in normal development and diseases, immunology and immunotherapy, radiation biology, clinical leukemias and bone marrow transplantation. The Nato workshop concentrated not only on analysis of cell systems useful for somatic gene therapy, but also on actual themes directly related to correction of human diseases. The latter aspects emphasized themes related to biotechnology, the first part was by nature more general. We also included a few contributions that discussed perspectives for the future of gene therapy and possible relationships to evolution.

- Softcover
Anbieter: Buchpark, Trebbin, DeutschlandBuchpark
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Gebraucht - Sehr gut
EUR 116,48
EUR 105,00 VersandVersand von Deutschland nach USAAnzahl: 1 verfügbar
Zustand: Sehr gut. Zustand: Sehr gut | Seiten: 304 | Sprache: Englisch | Produktart: Bücher | This publication was initiated on the occasion of the NATO-Advanced Study Institute (ASI) meeting ¿Stem Cells and their potential for clinical application¿ which took place from August 23 ¿ 25, 2006 in Kyiv and from August 26 ¿ 31, 2006… in Simeiz, Ukraine. The meeting was devoted to ¿hot topics¿ in Stem cell research such as Regulation of Haematopoietic and Non-haematopoietic Stem Cells, Clinical Application of Stem Cells, Preclinical Models and Gene Therapy. The editors are pleased that the original idea of a book could eventually be realised. This was made possible because of the willingness of many meeting participants to saddle themselves with the additional work of compiling their data and thoughts in form of an article for this edition. We are thus foremost grateful to all contributors for their valuable input. In accordance with the conference¿s main topics, the book is divided into five chapters - ¿Haematopoietic stem cells and haematopoiesis¿, ¿Biology of n- haematopoietic stem cells¿, ¿Stem cells and malignancy¿, ¿Cell processing; expansion and genetic modification¿ and ¿Clinical haematopoietic stem cell transplantation¿.

- Softcover
Anbieter: Buchpark, Trebbin, DeutschlandBuchpark
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Gebraucht - Sehr gut
EUR 116,48
EUR 105,00 VersandVersand von Deutschland nach USAAnzahl: 1 verfügbar
Zustand: Sehr gut. Zustand: Sehr gut | Seiten: 304 | Sprache: Englisch | Produktart: Bücher | This publication was initiated on the occasion of the NATO-Advanced Study Institute (ASI) meeting ¿Stem Cells and their potential for clinical application¿ which took place from August 23 ¿ 25, 2006 in Kyiv and from August 26 ¿ 31, 2006… in Simeiz, Ukraine. The meeting was devoted to ¿hot topics¿ in Stem cell research such as Regulation of Haematopoietic and Non-haematopoietic Stem Cells, Clinical Application of Stem Cells, Preclinical Models and Gene Therapy. The editors are pleased that the original idea of a book could eventually be realised. This was made possible because of the willingness of many meeting participants to saddle themselves with the additional work of compiling their data and thoughts in form of an article for this edition. We are thus foremost grateful to all contributors for their valuable input. In accordance with the conference¿s main topics, the book is divided into five chapters - ¿Haematopoietic stem cells and haematopoiesis¿, ¿Biology of n- haematopoietic stem cells¿, ¿Stem cells and malignancy¿, ¿Cell processing; expansion and genetic modification¿ and ¿Clinical haematopoietic stem cell transplantation¿.

- Softcover
Anbieter: AHA-BUCH GmbH, Einbeck, DeutschlandAHA-BUCH GmbH
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Neu
EUR 168,73
EUR 62,32 VersandVersand von Deutschland nach USAAnzahl: 1 verfügbar
Taschenbuch. Zustand: Neu. Druck auf Anfrage Neuware - Printed after ordering - This publication was initiated on the occasion of the NATO-Advanced Study Institute (ASI) meeting 'Stem Cells and their potential for clinical application' which took place from August 23 - 25, 2006 in Kyiv and from August 26 - 31, 2006 in Simeiz, Uk…raine. The meeting was devoted to 'hot topics' in Stem cell research such as Regulation of Haematopoietic and Non-haematopoietic Stem Cells, Clinical Application of Stem Cells, Preclinical Models and Gene Therapy. The editors are pleased that the original idea of a book could eventually be realised. This was made possible because of the willingness of many meeting participants to saddle themselves with the additional work of compiling their data and thoughts in form of an article for this edition. We are thus foremost grateful to all contributors for their valuable input. In accordance with the conference's main topics, the book is divided into five chapters - 'Haematopoietic stem cells and haematopoiesis', 'Biology of n- haematopoietic stem cells', 'Stem cells and malignancy', 'Cell processing; expansion and genetic modification' and 'Clinical haematopoietic stem cell transplantation'.

Verlag: Franz Steiner Verlag, Wiesbaden, 1966
- Softcover
Anbieter: Expatriate Bookshop of Denmark/John Jackson Books, Svendborg, DänemarkExpatriate Bookshop of Denmark/John Jackson Books
Verkäufer/-in kontaktierenVerkäufer/-in mit 5 SternenZustand: Gebraucht
EUR 39,68
EUR 59,00 VersandVersand von Dänemark nach USAAnzahl: 1 verfügbar
In den Warenkorborig. wrappers. Zustand: Unopened. Minor wear. VG. 25x17cm, 124 pp. Series: Akademie der Wissenschaften und der Literatur in Mainz, Abhandlungen der Mathematisch-Naturwissenschaftlichen Klasse, Jahrgang 1966, Nr. 1.