Sprache: Englisch
Verlag: Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
ISBN 10: 3540504192 ISBN 13: 9783540504191
Anbieter: Ammareal, Morangis, Frankreich
Hardcover. Zustand: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations.
Anbieter: Ria Christie Collections, Uxbridge, Vereinigtes Königreich
EUR 115,66
Anzahl: Mehr als 20 verfügbar
In den WarenkorbZustand: New. In.
Anbieter: Romtrade Corp., STERLING HEIGHTS, MI, USA
Zustand: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.
Sprache: Englisch
Verlag: Berlin ; Heidelberg ; New York ; London ; Paris ; Tokyo : Springer,, 1989
ISBN 10: 3540504192 ISBN 13: 9783540504191
Anbieter: Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein, Mannheim, Deutschland
gr.-8°,OPp, gebundene Ausgabe. VIII, 475 S : graph. Darst. ; 25 cm Fast neuwertiges, ungelesenes Exemplar. Sprache: Englisch Gewicht in Gramm: 1200.
Anbieter: Majestic Books, Hounslow, Vereinigtes Königreich
EUR 153,25
Anzahl: 1 verfügbar
In den WarenkorbZustand: Used. pp. 475.
Anbieter: Biblios, Frankfurt am main, HESSE, Deutschland
Zustand: Used. pp. 475.
Sprache: Englisch
Verlag: Springer Berlin Heidelberg, 2011
ISBN 10: 3642741991 ISBN 13: 9783642741999
Anbieter: moluna, Greven, Deutschland
EUR 118,64
Anzahl: Mehr als 20 verfügbar
In den WarenkorbZustand: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.
Anbieter: Revaluation Books, Exeter, Vereinigtes Königreich
EUR 160,13
Anzahl: 2 verfügbar
In den WarenkorbPaperback. Zustand: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.
Sprache: Englisch
Verlag: Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
ISBN 10: 3642741991 ISBN 13: 9783642741999
Anbieter: AHA-BUCH GmbH, Einbeck, Deutschland
Taschenbuch. Zustand: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .