Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Die Inhaltsangabe kann sich auf eine andere Ausgabe dieses Titels beziehen.
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
„Über diesen Titel“ kann sich auf eine andere Ausgabe dieses Titels beziehen.
Anbieter: WeBuyBooks, Rossendale, LANCS, Vereinigtes Königreich
Zustand: Good. Most items will be dispatched the same or the next working day. A copy that has been read but remains in clean condition. All of the pages are intact and the cover is intact and the spine may show signs of wear. The book may have minor markings which are not specifically mentioned. Artikel-Nr. rev5543284399
Anzahl: 1 verfügbar
Anbieter: WeBuyBooks, Rossendale, LANCS, Vereinigtes Königreich
Zustand: Very Good. Most items will be dispatched the same or the next working day. A copy that has been read, but is in excellent condition. Pages are intact and not marred by notes or highlighting. The spine remains undamaged. Artikel-Nr. rev6785044868
Anzahl: 1 verfügbar
Anbieter: World of Books (was SecondSale), Montgomery, IL, USA
Zustand: Good. Item in good condition. Textbooks may not include supplemental items i.e. CDs, access codes etc. Artikel-Nr. 00100519897
Anzahl: 2 verfügbar
Anbieter: WorldofBooks, Goring-By-Sea, WS, Vereinigtes Königreich
Paperback. Zustand: Very Good. The book has been read, but is in excellent condition. Pages are intact and not marred by notes or highlighting. The spine remains undamaged. Artikel-Nr. GOR005657825
Anzahl: 5 verfügbar
Anbieter: AwesomeBooks, Wallingford, Vereinigtes Königreich
Zustand: Very Good. This book is in very good condition and will be shipped within 24 hours of ordering. The cover may have some limited signs of wear but the pages are clean, intact and the spine remains undamaged. This book has clearly been well maintained and looked after thus far. Money back guarantee if you are not satisfied. See all our books here, order more than 1 book and get discounted shipping. . Artikel-Nr. 7719-9780241954690
Anzahl: 1 verfügbar
Anbieter: MusicMagpie, Stockport, Vereinigtes Königreich
Zustand: Very Good. 1784014767. 7/14/2026 7:39:27 AM. Artikel-Nr. U9780241954690
Anzahl: 1 verfügbar
Anbieter: Better World Books Ltd, Dunfermline, Vereinigtes Königreich
Zustand: Very Good. Former library copy. Pages intact with possible writing/highlighting. Binding strong with minor wear. Dust jackets/supplements may not be included. Includes library markings. Stock photo provided. Product includes identifying sticker. Better World Books: Buy Books. Do Good. Artikel-Nr. 10103157-6
Anzahl: 2 verfügbar
Anbieter: Better World Books Ltd, Dunfermline, Vereinigtes Königreich
Zustand: Good. Former library copy. Pages intact with minimal writing/highlighting. The binding may be loose and creased. Dust jackets/supplements are not included. Includes library markings. Stock photo provided. Product includes identifying sticker. Better World Books: Buy Books. Do Good. Artikel-Nr. GRP78703612
Anzahl: 1 verfügbar
Anbieter: Bahamut Media, Reading, Vereinigtes Königreich
Zustand: Very Good. Shipped within 24 hours from our UK warehouse. Clean, undamaged book with no damage to pages and minimal wear to the cover. Spine still tight, in very good condition. Remember if you are not happy, you are covered by our 100% money back guarantee. Artikel-Nr. 6545-9780241954690
Anzahl: 1 verfügbar
Anbieter: PBShop.store UK, Fairford, GLOS, Vereinigtes Königreich
PAP. Zustand: New. New Book. Shipped from UK. Established seller since 2000. Artikel-Nr. GB-9780241954690
Anzahl: 3 verfügbar